| Basic information from miRBase |
| hairpin accession number: MI0009963 |
| Located between position 108139366 and 108139473 on chromosome 8 strand + |
| Overlapping with sense strand of Fam65a-201 (3UTR 6). |
| (Ensemble: ENSMUST00000043531) |
| mature miRNAs for MI0009963: |
| mmu-miR-1966 (MIMAT0009439): AAGGGAGCTGGCTCAGGAGAGAGTC |
| You can find this miRNA in MGI: Mir1966 (accession: 3837211) |
| References |
| [1]Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK, Genome Res. 18:1787-1797(2008)., "In-depth characterization of the microRNA transcriptome in a leukemia progression model" |