miRNEST 2.0, an integrative microRNA resource

miRNEST 2.0, an integrative microRNA resource :: Browse

Basic information from miRBase

hairpin accession number: MI0009932

Located between position 79205658 and 79205730 on chromosome 15 strand -

Overlapping with sense strand of Tmem184b-201 (intron 3).

(Ensemble: ENSMUST00000074991)

mature miRNAs for MI0009932:

mmu-miR-1943 (MIMAT0009408): AAGGGAGGATCTGGGCACCTGGA

mmu-miR-1943* (MIMAT0017342): CAGGTGCCAGCTCCTCCCTTC

You can find this miRNA in MGI: Mir1943 (accession: 3836982)

References

[1]Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK, Genome Res. 18:1787-1797(2008)., "In-depth characterization of the microRNA transcriptome in a leukemia progression model"

[2]Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP, Genes Dev. 24:992-1009(2010)., "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"