miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0013666
Located between position 3239208 and 3239376 on chromosome 22 strand -
Overlapping with sense strand of (intron 1).
(Ensemble: ENSTGUT00000005583)
mature miRNAs for MI0013666:
         tgu-miR-2188 (MIMAT0014480): AAGGTCCAACCTCACATGTCCT

References
[1]Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li, Nature. 464:757-762(2010)., "The genome of a songbird"