miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0008451
Located between position 194250137 and 194250205 on chromosome 2b strand +
Overlapping with sense strand of XM_001163555.1 (intron 1).
(Ensemble: ENSPTRT00000023591)
mature miRNAs for MI0008451:
         ptr-miR-1245 (MIMAT0007971): AAGTGATCTAAAGGCCTACAT
You can find this miRNA in ENTREZGENE: MIR1245 (accession: 100316060)

References
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome"