miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0008641
Located between position 59466661 and 59466726 on chromosome 19 strand +
mature miRNAs for MI0008641:
         ptr-miR-371 (MIMAT0008121): AAGTGCCGCCATCTTTTGAGTGT
You can find this miRNA in ENTREZGENE: MIR371 (accession: 100316153)

References
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome"