Basic information from miRBase |
hairpin accession number: MI0008641 |
Located between position 59466661 and 59466726 on chromosome 19 strand + |
mature miRNAs for MI0008641: |
ptr-miR-371 (MIMAT0008121): AAGTGCCGCCATCTTTTGAGTGT |
You can find this miRNA in ENTREZGENE: MIR371 (accession: 100316153) |
References |
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |