| Basic information from miRBase |
| hairpin accession number: MI0012764 |
| Located between position 22831962 and 22832021 on chromosome 10 strand + |
| mature miRNAs for MI0012764: |
| eca-miR-371-5p (MIMAT0013013): ACTCAAACTGTGGGGGCACT |
| eca-miR-371-3p (MIMAT0013014): AAGTGCCGCCATTTTTTGAGTGT |
| You can find this miRNA in ENTREZGENE: MIR371 (accession: 100314837) |
| References |
| [1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" |