| Basic information from miRBase |
| hairpin accession number: MI0015473 |
| Located between position 134415246 and 134415361 on chromosome 6 strand - |
| mature miRNAs for MI0015473: |
| rno-miR-3592 (MIMAT0017895): AAGTGTTGTCCGTGAATGATT |
| You can find this miRNA in ENTREZGENE: Mir3592 (accession: 100526609) |
| References |
| [1]Linsen SE, de Wit E, de Bruijn E, Cuppen E, BMC Genomics. 11:249(2010)., "Small RNA expression and strain specificity in the rat" |