| Basic information from miRBase |
| hairpin accession number: MI0011549 |
| Located between position 34504824 and 34504887 on chromosome X strand - |
| Overlapping with antisense strand of ATG4A_BOVIN (intron 1). |
| (Ensemble: ENSBTAT00000018239) |
| mature miRNAs for MI0011549: |
| bta-miR-2284e (MIMAT0012080): AAGTTCGTTCGGATTTTTCC |
| You can find this miRNA in ENTREZGENE: MIR2284E (accession: 100313449) |
| References |
| [1]Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ, PLoS One. 4:e6349(2009)., "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" |