| Basic information from miRBase |
| hairpin accession number: MI0008639 |
| Located between position 101497909 and 101497977 on chromosome 14 strand + |
| mature miRNAs for MI0008639: |
| ptr-miR-369 (MIMAT0008119): AATAATACATGGTTGATCTTT |
| You can find this miRNA in ENTREZGENE: MIR369 (accession: 100316152) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |