| Basic information from miRBase |
| hairpin accession number: MI0008658 |
| Located between position 101498223 and 101498301 on chromosome 14 strand + |
| mature miRNAs for MI0008658: |
| ptr-miR-410 (MIMAT0008137): AATATAACACAGATGGCCTGT |
| You can find this miRNA in ENTREZGENE: MIR410 (accession: 100316525) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |