miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0008658
Located between position 101498223 and 101498301 on chromosome 14 strand +
mature miRNAs for MI0008658:
         ptr-miR-410 (MIMAT0008137): AATATAACACAGATGGCCTGT
You can find this miRNA in ENTREZGENE: MIR410 (accession: 100316525)

References
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome"