| Basic information from miRBase |
| hairpin accession number: MI0015573 |
| Located between position 2649121 and 2649173 on chromosome 4q strand - |
| Overlapping with sense strand of (intron 1). |
| (Ensemble: ENSCINT00000002922) |
| mature miRNAs for MI0015573: |
| cin-miR-4022-3p (MIMAT0016537): AATATGAGTTTATATTTACA |
| You can find this miRNA in ENTREZGENE: mir4022 (accession: 100499060) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |