| PROMOTER INFORMATION | ||||||||||||||
| 147 | chr11, 110888303-110889419, + | promoter sequence | Marson et al. |  | | |||||||||
| 920 | chr11, 110884374-110889450, + | promoter sequence | UCSC | | | |||||||||
| more data |
| Expression data from dbDEMC |
| Expression data from PhenomiR |
| Basic information from miRBase |
| hairpin accession number: MI0000743 |
| Located between position 111384164 and 111384240 on chromosome 11 strand + |
| Overlapping with sense strand of AP002008.1-201 (exon 2). |
| (Ensemble: ENST00000540312) |
| mature miRNAs for MI0000743: |
| hsa-miR-34c-5p (MIMAT0000686): AGGCAGTGTAGTTAGCTGATTGC |
| hsa-miR-34c-3p (MIMAT0004677): AATCACTAACCACACGGCCAGG |
| You can find this miRNA in TARGETS:PICTAR-VERT: hsa-miR-34c (accession: hsa-miR-34c) |
| References | ||||||||||||||
| [1]Houbaviy HB, Murray MF, Sharp PA, Dev Cell. 5:351-358(2003)., "Embryonic stem cell-specific MicroRNAs" | ||||||||||||||
| [2]Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing" | ||||||||||||||
| PROMOTER INFORMATION | ||||||||||||||
| 147 | chr11, 110888303-110889419, + | promoter sequence | Marson et al. | | | |||||||||
| 920 | chr11, 110884374-110889450, + | promoter sequence | UCSC | | | |||||||||
| more data |
| Expression data from dbDEMC |
| Expression data from PhenomiR |