miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0014808
Located between position 108239300 and 108239376 on chromosome 11 strand +
mature miRNAs for MI0014808:
         ppy-miR-34c-5p (MIMAT0015742): AGGCAGTGTAGTTAGCTGATTGC
         ppy-miR-34c-3p (MIMAT0015743): AATCACTAACCACACGGCCAGG

References
[1]Brameier M, BMC Res Notes. 3:64(2010)., "Genome-wide comparative analysis of microRNAs in three non-human primates"