| Basic information from miRBase |
| hairpin accession number: MI0008633 |
| Located between position 110286344 and 110286419 on chromosome 11 strand + |
| mature miRNAs for MI0008633: |
| ptr-miR-34c (MIMAT0008114): AATCACTAACCACACGGCCAGG |
| You can find this miRNA in ENTREZGENE: MIR34C (accession: 100316149) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |