miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0015653
Located between position 5166716 and 5166768 on chromosome 7q strand -
mature miRNAs for MI0015653:
         cin-miR-4100-5p (MIMAT0016684): TGAGCTTTCGTCTTATGATTG
         cin-miR-4100-3p (MIMAT0016685): AATCATTAGATGAAAACTCACG
You can find this miRNA in ENTREZGENE: mir4100 (accession: 100499070)

References
[1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data"