Basic information from miRBase |
hairpin accession number: MI0015653 |
Located between position 5166716 and 5166768 on chromosome 7q strand - |
mature miRNAs for MI0015653: |
cin-miR-4100-5p (MIMAT0016684): TGAGCTTTCGTCTTATGATTG |
cin-miR-4100-3p (MIMAT0016685): AATCATTAGATGAAAACTCACG |
You can find this miRNA in ENTREZGENE: mir4100 (accession: 100499070) |
References |
[1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |