miRNEST 2.0, an integrative microRNA resource

miRNEST 2.0, an integrative microRNA resource :: Browse

Basic information from miRBase

hairpin accession number: MI0009811

Located between position 54771217 and 54771281 on chromosome X strand -

mature miRNAs for MI0009811:

bta-miR-362-5p (MIMAT0009298): AATCCTTGGAACCTAGGTGTGAGT

bta-miR-362-3p (MIMAT0012548): AACACACCTATTCAAGGATTC

You can find this miRNA in ENTREZGENE: MIR362 (accession: 100313038)

References

[1]Artzi S, Kiezun A, Shomron N, BMC Bioinformatics. 9:39(2008)., "miRNAminer: a tool for homologous microRNA gene search"

[2]Strozzi F, Mazza R, Malinverni R, Williams JL, Anim Genet. 40:125(2009)., "Annotation of 390 bovine miRNA genes by sequence similarity with other species"

[3]Long JE, Chen HX, Biochem Genet. 47:329-343(2009)., "Identification and characteristics of cattle microRNAs by homology searching and small RNA cloning"

[4]Jin W, Grant JR, Stothard P, Moore SS, Guan LL, BMC Mol Biol. 10:90(2009)., "Characterization of bovine miRNAs by sequencing and bioinformatics analysis"