| Basic information from miRBase |
| hairpin accession number: MI0012957 |
| Located between position 40073827 and 40073892 on chromosome X strand + |
| Overlapping with sense strand of LOC100052289 (intron 1). |
| (Ensemble: ENSECAT00000011707) |
| mature miRNAs for MI0012957: |
| eca-miR-362-5p (MIMAT0013210): AATCCTTGGAACCTAGGTGTGAGT |
| eca-miR-362-3p (MIMAT0013211): AACACACCTATTCAAGGATTCA |
| You can find this miRNA in ENTREZGENE: MIR362 (accession: 100314998) |
| References |
| [1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" |