| Basic information from miRBase |
| hairpin accession number: MI0015613 |
| Located between position 1331354 and 1331416 on chromosome 5q strand + |
| Overlapping with sense strand of (intron 14). |
| (Ensemble: ENSCINT00000023251) |
| mature miRNAs for MI0015613: |
| cin-miR-4062-5p (MIMAT0016612): CGCCTGCATCTTTACAGCTT |
| cin-miR-4062-3p (MIMAT0016613): AATGCTGTAAAATAAAGGCA |
| You can find this miRNA in ENTREZGENE: mir4062 (accession: 100499112) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |