| Basic information from miRBase |
| hairpin accession number: MI0012982 |
| Located between position 86921316 and 86921413 on chromosome X strand + |
| Overlapping with sense strand of LOC100054407 (intron 1). |
| (Ensemble: ENSECAT00000007700) |
| mature miRNAs for MI0012982: |
| eca-miR-652 (MIMAT0013240): AATGGCGCCACTAGGGTTGTG |
| You can find this miRNA in ENTREZGENE: MIR652 (accession: 100314957) |
| References |
| [1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" |