Basic information from miRBase |
hairpin accession number: MI0008167 |
Located between position 86340979 and 86341041 on chromosome X strand + |
Overlapping with sense strand of XM_858098.1 (intron 2). |
(Ensemble: ENSCAFT00000028733) |
mature miRNAs for MI0008167: |
cfa-miR-652 (MIMAT0006743): AATGGCGCCACTAGGGTTGTGC |
References |
[1]Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N, Nat Biotechnol. 26:407-415(2008)., "Discovering microRNAs from deep sequencing data using miRDeep" ![]() |