| Basic information from miRBase |
| hairpin accession number: MI0004716 |
| Located between position 542222 and 542332 on chromosome scaffold_100 strand + |
| mature miRNAs for MI0004716: |
| ppt-miR1217-5p (MIMAT0004830): TGGTATCATGTTGCAAATGGC |
| ppt-miR1217-3p (MIMAT0003906): AATTTGAAGCATGATGTCAAG |
| References |
| [1]Talmor-Neiman M, Stav R, Frank W, Voss B, Arazi T, Plant J. 47:25-37(2006)., "Novel micro-RNAs and intermediates of micro-RNA biogenesis from moss" |
| [2]Axtell MJ, Snyder JA, Bartel DP, Plant Cell. 19:1750-1769(2007)., "Common functions for diverse small RNAs of land plants" |