Basic information from miRBase |
hairpin accession number: MI0015562 |
Located between position 15167 and 15216 on chromosome scaffold_890 strand + |
mature miRNAs for MI0015562: |
cin-miR-4015-5p (MIMAT0016520): ACAATGAAATTAACCTTCTC |
cin-miR-4015-3p (MIMAT0016521): GGATAGGTTGAATTCATCGT |
You can find this miRNA in ENTREZGENE: mir4015-2 (accession: 100499103) |
References |
[1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" ![]() |