| Basic information from miRBase |
| hairpin accession number: MI0015562 |
| Located between position 15167 and 15216 on chromosome scaffold_890 strand + |
| mature miRNAs for MI0015562: |
| cin-miR-4015-5p (MIMAT0016520): ACAATGAAATTAACCTTCTC |
| cin-miR-4015-3p (MIMAT0016521): GGATAGGTTGAATTCATCGT |
| You can find this miRNA in ENTREZGENE: mir4015-2 (accession: 100499103) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |