Basic information from miRBase |
hairpin accession number: MI0005836 |
Located between position 19455870 and 19455964 on chromosome X strand + |
Overlapping with antisense strand of Grip84-RD (3UTR 5). |
(Ensemble: FBtr0301307) (FlyBase: FlyBase) |
mature miRNAs for MI0005836: |
dme-miR-979-5p (MIMAT0020876): ACACTGAATTTGGGGGGAATTCT |
dme-miR-979-3p (MIMAT0005495): TTCTTCCCGAACTCAGGCTAA |
References |
[1]Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC, Genome Res. 17:1850-1864(2007)., "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" ![]() |
more data |
Data from CoGemiR |