| Basic information from miRBase |
| hairpin accession number: MI0002857 |
| Located between position 151621172 and 151621281 on chromosome 1 strand - |
| Overlapping with antisense strand of XM_513998.2 (intron 14). |
| (Ensemble: ENSPTRT00000048641) |
| mature miRNAs for MI0002857: |
| ptr-miR-214 (MIMAT0002554): ACAGCAGGCACAGACAGGCAG |
| You can find this miRNA in EMBL: AY866216 (accession: AY866216) |
| References |
| [1]Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E, Cell. 120:21-24(2005)., "Phylogenetic shadowing and computational identification of human microRNA genes" |