| Basic information from miRBase |
| hairpin accession number: MI0008464 |
| Located between position 57336861 and 57336945 on chromosome 19 strand + |
| mature miRNAs for MI0008464: |
| ptr-miR-125a (MIMAT0007984): ACAGGTGAGGTTCTTGGGAGCC |
| You can find this miRNA in ENTREZGENE: MIR125A (accession: 100316067) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |