| PROMOTER INFORMATION | ||||||||||||||
| 894 | chr10, 105797837-105802934, - | promoter sequence | UCSC |  | | |||||||||
| more data |
| Expression data from dbDEMC |
| Basic information from miRBase |
| hairpin accession number: MI0005758 |
| Located between position 105807847 and 105807944 on chromosome 10 strand - |
| Overlapping with sense strand of COL17A1-003 (exon 30). |
| (Ensemble: OTTHUMT00000050183) |
| mature miRNAs for MI0005758: |
| hsa-miR-936 (MIMAT0004979): ACAGTAGAGGGAGGAATCGCAG |
| You can find this miRNA in HGNC: MIR936 (accession: 33679) |
| References | ||||||||||||||
| [1]Lui WO, Pourmand N, Patterson BK, Fire A, Cancer Res. 67:6031-6043(2007)., "Patterns of known and novel small RNAs in human cervical cancer" | ||||||||||||||
| PROMOTER INFORMATION | ||||||||||||||
| 894 | chr10, 105797837-105802934, - | promoter sequence | UCSC | | | |||||||||
| more data |
| Expression data from dbDEMC |