| Basic information from miRBase |
| hairpin accession number: MI0008571 |
| Located between position 11093658 and 11093727 on chromosome 19 strand - |
| Overlapping with antisense strand of (intron 12). |
| (Ensemble: ENSPTRT00000066778) |
| mature miRNAs for MI0008571: |
| ptr-miR-199a-3p (MIMAT0009192): ACAGTAGTCTGCACATTGGTTA |
| You can find this miRNA in ENTREZGENE: MIR199A-1 (accession: 100316116) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |