| Basic information from miRBase |
| hairpin accession number: MI0008572 |
| Located between position 128072099 and 128072207 on chromosome 9 strand - |
| Overlapping with antisense strand of (intron 14). |
| (Ensemble: ENSPTRT00000045024) |
| mature miRNAs for MI0008572: |
| ptr-miR-199b (MIMAT0008062): ACAGTAGTCTGCACATTGGTTA |
| You can find this miRNA in ENTREZGENE: MIR199B (accession: 100316117) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |