| Basic information from miRBase |
| hairpin accession number: MI0008820 |
| Located between position 90858205 and 90858299 on chromosome 13 strand + |
| mature miRNAs for MI0008820: |
| ptr-miR-622 (MIMAT0008283): ACAGTCTGCTGAGGTTGGAGC |
| You can find this miRNA in ENTREZGENE: MIR622 (accession: 100316352) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |