| Basic information from miRBase |
| hairpin accession number: MI0015582 |
| Located between position 7488678 and 7488731 on chromosome 1q strand + |
| mature miRNAs for MI0015582: |
| cin-miR-4031-5p (MIMAT0016551): CCCAAAGTGTCGGCGCATAT |
| cin-miR-4031-3p (MIMAT0016552): ACATGTACCGTCGCTCTGGG |
| You can find this miRNA in ENTREZGENE: mir4031 (accession: 100498913) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |