Basic information from miRBase |
hairpin accession number: MI0010939 |
Located between position 12895 and 12978 on chromosome Contig9421 strand - |
mature miRNAs for MI0010939: |
sme-miR-2206-5p (MIMAT0011402): AGGGCAGGCATAGCTAAGTG |
sme-miR-2206-3p (MIMAT0011403): ACCACTGGTGCGATCCTGCC |
References |
[1]Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR, RNA. 15:1483-1491(2009)., "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" ![]() |