Basic information from miRBase |
hairpin accession number: MI0015571 |
Located between position 39348 and 39411 on chromosome scaffold_197 strand - |
Overlapping with sense strand of (intron 9). |
(Ensemble: ENSCINT00000029050) |
mature miRNAs for MI0015571: |
cin-miR-4020b-5p (MIMAT0016533): GTGTGGTTGGTTGGTGGTTG |
cin-miR-4020b-3p (MIMAT0016534): ACCCATTCATTCCCCGCACA |
You can find this miRNA in ENTREZGENE: mir4020b (accession: 100498908) |
References |
[1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" ![]() |