miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0008453
Located between position 102002334 and 102002468 on chromosome 14 strand -
mature miRNAs for MI0008453:
         ptr-miR-1247 (MIMAT0007973): ACCCGTCCCGTTCGTCCCCGGA
You can find this miRNA in ENTREZGENE: MIR1247 (accession: 100316061)

References
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome"