| Basic information from miRBase |
| hairpin accession number: MI0008454 |
| Located between position 192369084 and 192369188 on chromosome 3 strand + |
| Overlapping with sense strand of (exon 1). |
| (Ensemble: ENSPTRT00000072174) |
| mature miRNAs for MI0008454: |
| ptr-miR-1248 (MIMAT0007974): ACCTTCTTGTATAAGCACTGTGCTAAA |
| You can find this miRNA in ENTREZGENE: MIR1248 (accession: 100316411) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |