miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0008456
Located between position 81317901 and 81318012 on chromosome 17 strand -
Overlapping with sense strand of (intron 2).
(Ensemble: ENSPTRT00000017918)
mature miRNAs for MI0008456:
         ptr-miR-1250 (MIMAT0007976): ACGGTGCTGGATGTGGCCTTT
You can find this miRNA in ENTREZGENE: MIR1250 (accession: 100316063)

References
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome"