Basic information from miRBase |
hairpin accession number: MI0008456 |
Located between position 81317901 and 81318012 on chromosome 17 strand - |
Overlapping with sense strand of (intron 2). |
(Ensemble: ENSPTRT00000017918) |
mature miRNAs for MI0008456: |
ptr-miR-1250 (MIMAT0007976): ACGGTGCTGGATGTGGCCTTT |
You can find this miRNA in ENTREZGENE: MIR1250 (accession: 100316063) |
References |
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |