| Basic information from miRBase |
| hairpin accession number: MI0015746 |
| Located between position 28178 and 28255 on chromosome 8q strand - |
| Overlapping with antisense strand of (intron 2). |
| (Ensemble: ENSCINT00000024830) |
| mature miRNAs for MI0015746: |
| cin-miR-4189-5p (MIMAT0016807): ACGTGCGTGGTAGTTTAACCT |
| You can find this miRNA in ENTREZGENE: mir4189 (accession: 100499155) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |