| Basic information from miRBase |
| hairpin accession number: MI0017393 |
| Located between position 54290931 and 54290996 on chromosome 19 strand - |
| Overlapping with antisense strand of MIR371-201 (exon 1). |
| (Ensemble: ENST00000362161) |
| mature miRNAs for MI0017393: |
| hsa-miR-371b-5p (MIMAT0019892): ACTCAAAAGATGGCGGCACTTT |
| hsa-miR-371b-3p (MIMAT0019893): AAGTGCCCCCACAGTTTGAGTGC |
| References |
| [1]Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C, Cancer Res. 71:78-86(2011)., "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" |