miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0015753
Located between position 4599 and 4662 on chromosome scaffold_2935 strand +
mature miRNAs for MI0015753:
         cin-miR-4196-5p (MIMAT0016815): ACTCCAAAACAGAGCACAGCG
You can find this miRNA in ENTREZGENE: mir4196 (accession: 100499003)

References
[1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data"