Basic information from miRBase |
hairpin accession number: MI0015753 |
Located between position 4599 and 4662 on chromosome scaffold_2935 strand + |
mature miRNAs for MI0015753: |
cin-miR-4196-5p (MIMAT0016815): ACTCCAAAACAGAGCACAGCG |
You can find this miRNA in ENTREZGENE: mir4196 (accession: 100499003) |
References |
[1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" ![]() |