| Basic information from miRBase |
| hairpin accession number: MI0008526 |
| Located between position 103837056 and 103837203 on chromosome 10 strand - |
| Overlapping with sense strand of XM_001134771.1 (intron 1). |
| (Ensemble: ENSPTRT00000005540) |
| mature miRNAs for MI0008526: |
| ptr-miR-1307 (MIMAT0008024): ACTCGGCGTGGCGTCGGTCGTG |
| You can find this miRNA in ENTREZGENE: MIR1307 (accession: 100316520) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |