| PROMOTER INFORMATION | ||||||||||||||
| 947 | chr12, 96404818-96409887, + | promoter sequence | UCSC |  | | |||||||||
| Basic information from miRBase |
| hairpin accession number: MI0006386 |
| Located between position 97885687 and 97885756 on chromosome 12 strand + |
| Overlapping with sense strand of RMST-202 (intron 2). |
| (Ensemble: ENST00000541282) |
| mature miRNAs for MI0006386: |
| hsa-miR-1251 (MIMAT0005903): ACTCTAGCTGCCAAAGGCGCT |
| You can find this miRNA in HGNC: MIR1251 (accession: 35317) |
| References | ||||||||||||||
| [1]Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA, Genome Res. 18:610-621(2008)., "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" | ||||||||||||||
| [2]Kawaji H, Nakamura M, Takahashi Y, Sandelin A, Katayama S, Fukuda S, Daub CO, Kai C, Kawai J, Yasuda J, Carninci P, Hayashizaki Y, BMC Genomics. 9:157(2008)., "Hidden layers of human small RNAs" | ||||||||||||||
| PROMOTER INFORMATION | ||||||||||||||
| 947 | chr12, 96404818-96409887, + | promoter sequence | UCSC | | | |||||||||