| Basic information from miRBase |
| hairpin accession number: MI0014021 |
| Located between position 91599885 and 91599968 on chromosome 10 strand - |
| Overlapping with sense strand of Rmst-202 (intron 3). |
| (Ensemble: ENSMUST00000137229) |
| mature miRNAs for MI0014021: |
| mmu-miR-1251 (MIMAT0014824): ACTCTAGCTGCCAAAGGCGCT |
| mmu-miR-1251* (MIMAT0014825): CGCTTTGCTCAGCCAGTGTAG |
| You can find this miRNA in ENTREZGENE: Mir1251 (accession: 100526517) |
| References |
| [1]Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP, Genes Dev. 24:992-1009(2010)., "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" |