| Basic information from miRBase |
| hairpin accession number: MI0009949 |
| Located between position 32507849 and 32507934 on chromosome 2 strand + |
| Overlapping with sense strand of Eng-002 (intron 1). |
| (Ensemble: OTTMUST00000028347) |
| mature miRNAs for MI0009949: |
| mmu-miR-1954 (MIMAT0009425): ACTGCAGAGTGAGACCCTGTT |
| You can find this miRNA in MGI: Mir1954 (accession: 3837035) |
| References |
| [1]Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK, Genome Res. 18:1787-1797(2008)., "In-depth characterization of the microRNA transcriptome in a leukemia progression model" |