| Basic information from miRBase |
| hairpin accession number: MI0008616 |
| Located between position 7388016 and 7388097 on chromosome 17 strand - |
| Overlapping with antisense strand of (intron 11). |
| (Ensemble: ENSPTRT00000045555) |
| mature miRNAs for MI0008616: |
| ptr-miR-324 (MIMAT0008098): ACTGCCCCAGGTGCTGCTGG |
| You can find this miRNA in ENTREZGENE: MIR324 (accession: 100316328) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |