miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0008806
Located between position 122763875 and 122763971 on chromosome 9 strand -
mature miRNAs for MI0008806:
         ptr-miR-600 (MIMAT0008269): ACTTACAGACAAGAGCCTTGCTC
You can find this miRNA in ENTREZGENE: MIR600 (accession: 100316494)

References
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome"