Basic information from miRBase |
hairpin accession number: MI0008806 |
Located between position 122763875 and 122763971 on chromosome 9 strand - |
mature miRNAs for MI0008806: |
ptr-miR-600 (MIMAT0008269): ACTTACAGACAAGAGCCTTGCTC |
You can find this miRNA in ENTREZGENE: MIR600 (accession: 100316494) |
References |
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |