| Basic information from miRBase |
| hairpin accession number: MI0018235 |
| Located between position 14779421 and 14779487 on chromosome Bd3 strand - |
| mature miRNAs for MI0018235: |
| bdi-miR5203 (MIMAT0020760): ACTTATTATGGACCGGAGGGA |
| References |
| [1]Zhang J, Xu Y, Huan Q, Chong K, BMC Genomics. 10:449(2009)., "Deep sequencing of Brachypodium small RNAs at the global genome level identifies microRNAs involved in cold stress response" |