| Basic information from miRBase |
| hairpin accession number: MI0016047 |
| Located between position 70563402 and 70563502 on chromosome 16 strand + |
| Overlapping with sense strand of SF3B3-001 (intron 3). |
| (Ensemble: OTTHUMT00000268972) |
| mature miRNAs for MI0016047: |
| hsa-miR-3647-5p (MIMAT0018066): CTGAAGTGATGATTCACATTCAT |
| hsa-miR-3647-3p (MIMAT0018067): AGAAAATTTTTGTGTGTCTGATC |
| You can find this miRNA in ENTREZGENE: MIR3647 (accession: 100500806) |
| References |
| [1]Meiri E, Levy A, Benjamin H, Ben-David M, Cohen L, Dov A, Dromi N, Elyakim E, Yerushalmi N, Zion O, Lithwick-Yanai G, Sitbon E, Nucleic Acids Res. 38:6234-6246(2010)., "Discovery of microRNAs and other small RNAs in solid tumors" |