miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0014213
Located between position 14995365 and 14995448 on chromosome 16 strand +
Overlapping with sense strand of NPIP-201 (intron 3).
(Ensemble: ENST00000432470)
mature miRNAs for MI0014213:
         hsa-miR-3179 (MIMAT0015056): AGAAGGGGTGAAATTTAAACGT
You can find this miRNA in ENTREZGENE: MIR3179-1 (accession: 100422960)

References
[1]Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK, PLoS One. 5:e9685(2010)., "Characterization of the Melanoma miRNAome by Deep Sequencing"
[2]Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH, PLoS One. 5:e9637(2010)., "Discovery of novel microRNAs in female reproductive tract using next generation sequencing"
[3]Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C, Cancer Res. 71:78-86(2011)., "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"