miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0009977
Located between position 51481209 and 51481343 on chromosome SL2.40ch11 strand +
mature miRNAs for MI0009977:
         sly-miR172b (MIMAT0009144): AGAATCTTGATGATGCTGCAT

References
[1]Zhang J, Zeng R, Chen J, Liu X, Liao Q, Gene. 423:1-7(2008)., "Identification of conserved microRNAs and their targets from Solanum lycopersicum Mill"