| Basic information from miRBase |
| hairpin accession number: MI0008585 |
| Located between position 128218829 and 128218924 on chromosome 9 strand - |
| mature miRNAs for MI0008585: |
| ptr-miR-219-5p (MIMAT0009193): TGATTGTCCAAACGCAATTCT |
| ptr-miR-219-2-3p (MIMAT0009194): AGAATTGTGGCTGGACATCTGT |
| You can find this miRNA in ENTREZGENE: MIR219-2 (accession: 100316124) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |