| Basic information from miRBase |
| hairpin accession number: MI0008816 |
| Located between position 81479553 and 81479648 on chromosome 12 strand - |
| Overlapping with sense strand of XR_021171.1 (intron 7). |
| (Ensemble: ENSPTRT00000009675) RefSeq_dna: RefSeq) |
| mature miRNAs for MI0008816: |
| ptr-miR-617 (MIMAT0008279): AGACTTCCCATTTGAAGGTGGC |
| You can find this miRNA in ENTREZGENE: MIR617 (accession: 100316247) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |